View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_75 (Length: 241)

Name: NF0917_low_75
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_75
NF0917_low_75
[»] chr4 (1 HSPs)
chr4 (1-116)||(12065238-12065353)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 12065353 - 12065238
Alignment:
1 cattgatcatcaaacttcaaatttcatccatatccactcaacctagtagctttatttcaggaccacggcgcggctacaattgacgccacatcagcctcag 100  Q
    |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||     
12065353 cattgatcattaaacttcaaatttcatccatatccactcaaccaagtagctttatttcaggaccacggcgtggccacaattgacgccacagcagcctcat 12065254  T
101 aacatcaacttcatct 116  Q
    ||||||||||||||||    
12065253 aacatcaacttcatct 12065238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University