View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_78 (Length: 230)

Name: NF0917_low_78
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_78
NF0917_low_78
[»] chr1 (1 HSPs)
chr1 (21-122)||(37167003-37167104)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 21 - 122
Target Start/End: Complemental strand, 37167104 - 37167003
Alignment:
21 tgtctaaagccacacacaaccatctaccaattttccatagccacttaacatgaaaacatcaactactgctattgtgtccctctttattaccctcttcatc 120  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
37167104 tgtctaaagccacacacaaccatctaccaattttccatagccaattaacatgaaaacatcaactaccactattgtgtccctctttattaccctcttcatc 37167005  T
121 tc 122  Q
    ||    
37167004 tc 37167003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University