View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_high_24 (Length: 314)
Name: NF0918_high_24
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_high_24 |
 |  |
|
[»] scaffold0175 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0175 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 260
Target Start/End: Complemental strand, 33072 - 32818
Alignment:
Q |
6 |
agaaacaaaggcacaataggagggagataaacgatgatatgacaagaaattataaatagggtaaggattacgggttgaacggttacatttacggatggga |
105 |
Q |
|
|
||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33072 |
agaaacaaaagcacaataggcggaagataaacgatgatatgacaagaaattataaatagggtaaggattacgggttgaacggttacatttacggatggga |
32973 |
T |
 |
Q |
106 |
agggtcatatcaggagatggagatggagacgcagatcgatccggagtagggtacgaaacacttggaacaggaactgaagcatgtggttcaacccttctct |
205 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
T |
32972 |
atggtcatatcaggagatggagatggagacgcagatcattccggagtaggggacgaaacacttggaataggaattgaagcatgtggttcaacccttctct |
32873 |
T |
 |
Q |
206 |
cataagtgatgccatactagttaataggtggaggagagttggttggagatgatgt |
260 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
32872 |
cataagtgatgccataccagttaataggtggaggagagttggttggagatgatgt |
32818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University