View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_high_32 (Length: 259)
Name: NF0918_high_32
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 252
Target Start/End: Original strand, 24428905 - 24429143
Alignment:
| Q |
22 |
catcaacatatctatctttctaatctattcctacaaccttccatcgatgcaagcaataatagaatttttaaaatttcccatttaaattgaacccacaaca |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24428905 |
catcatcatatctatctttctaatctattcctacaaccttccatcgatgcaagcaataatagaatttttaaaatttcccatttaaattgaacccacaaca |
24429004 |
T |
|
| Q |
122 |
acactgcctcgtcttatataaaagtaaaacccctactctgaatatcgtgtgctcgctctttttgttgtttggtggagaaacaagtcatcg--------tt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24429005 |
acactgcctcgtcttatataaaagtaaaacccctactctaaatatcgtgtgctcgctctttttgttgtttggtggagaaacaagtcatcgttgtggactt |
24429104 |
T |
|
| Q |
214 |
gtggactttggaagagaaaaacaatggcaacagctaggg |
252 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
24429105 |
gtggactttggaagagaaaaacaatgggaccagctaggg |
24429143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 218
Target Start/End: Original strand, 14438706 - 14438757
Alignment:
| Q |
168 |
gtgtgctcgctct-ttttgttgtttggtggagaaacaagtcatcgttgtgga |
218 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
14438706 |
gtgtgctcgctctcttttgttatttggtggagaaacgagtcatggttgtgga |
14438757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 787 times since January 2019
Visitors: 6705