View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_high_33 (Length: 258)
Name: NF0918_high_33
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_high_33 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] scaffold0034 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 7450020 - 7450248
Alignment:
| Q |
30 |
cattgttgttcgtgtgctccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttggactggttctctagccgtcctaagcacc |
129 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450020 |
cattgttgttcgtgtgctccttgaggcgatgcaccttagtttgatggacgttcggtccacgtgtcaatgttggactggttctctagccgtcctaagcacc |
7450119 |
T |
|
| Q |
130 |
atccaatcaccaatatgctccatttaattgattcgttgacccacatattatccagaaagccaaatcataaagtttgatcagggtgtgcttgagaaccacg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450120 |
atccaatcaccaatatgctccatttaattgattcgttgacgcacatattatccagagagccaaatcataaagtttgatcagggtgtgcttgagaaccacg |
7450219 |
T |
|
| Q |
230 |
aaacaatccatgacataaagtttaaaata |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7450220 |
aaacaatccatgacataaagtttaaaata |
7450248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 41 - 102
Target Start/End: Original strand, 4477406 - 4477467
Alignment:
| Q |
41 |
gtgtgctccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgg |
102 |
Q |
| |
|
||||||||||| || ||||| |||| | ||| |||||||||||||||||||||| |||||| |
|
|
| T |
4477406 |
gtgtgctccttgagttgatgcgccttggcctggtggacgttcgatccacgtgtcagtgttgg |
4477467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 50 - 103
Target Start/End: Original strand, 3982885 - 3982938
Alignment:
| Q |
50 |
ttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgga |
103 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | ||||| |||||| |||||| |
|
|
| T |
3982885 |
ttcaggcgatgtaccttagtttgatggacgtttggtccacatgtcaacgttgga |
3982938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 95
Target Start/End: Complemental strand, 8907 - 8859
Alignment:
| Q |
47 |
tccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtca |
95 |
Q |
| |
|
||||||||||||||||||||||| || ||| |||| ||||||| ||||| |
|
|
| T |
8907 |
tccttcaggcgatgcaccttagtatggtgggcgtttgatccacatgtca |
8859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 103
Target Start/End: Original strand, 8019188 - 8019248
Alignment:
| Q |
43 |
gtgctccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgga |
103 |
Q |
| |
|
||||||||||| ||||||| |||| ||||| |||||||| | | ||||||||| ||||||| |
|
|
| T |
8019188 |
gtgctccttcaagcgatgcgccttggtctggtggacgtttggttcacgtgtcagtgttgga |
8019248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 360 times since January 2019
Visitors: 6703