View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0918_high_34 (Length: 255)

Name: NF0918_high_34
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0918_high_34
NF0918_high_34
[»] chr8 (2 HSPs)
chr8 (29-255)||(38626566-38626792)
chr8 (40-109)||(38652857-38652926)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 38626792 - 38626566
Alignment:
29 agcaaccacagtggcttctcttcaaacttcagtgtcactgtcagcttcttattcttcaacttctacaactactaattttgcnnnnnnnnnnnnnnnnnnn 128  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                       
38626792 agcaaccacagtggcttctcttcaaacttcagtgtcactgtcagcttcttattcttcaacttctacaactactaattttgcctttttttttttttttttt 38626693  T
129 nnggaccaaattttgattcttcttttatttctccaatttaatggccttcgggtttaattttattcttcaatttcgttatggacaannnnnnnatgttatt 228  Q
      |||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||       ||||||||    
38626692 ttggactaaattttgattcttcttttagttctccaatttaatggccttcgggtttaatcttattcttcaatttcattatggacaattgtttaatgttatt 38626593  T
229 cctcaccaacccagttagcaacatttc 255  Q
    |||||||||| |||| |||||||||||    
38626592 cctcaccaacacagtgagcaacatttc 38626566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 40 - 109
Target Start/End: Complemental strand, 38652926 - 38652857
Alignment:
40 tggcttctcttcaaacttcagtgtcactgtcagcttcttattcttcaacttctacaactactaattttgc 109  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||| ||||||    
38652926 tggcttctcttcaaacttcagtgtcaccgtcagcttcttattcttcaagttatacaactactacttttgc 38652857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 123 times since January 2019
Visitors: 6713