View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_high_34 (Length: 255)
Name: NF0918_high_34
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_high_34 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 38626792 - 38626566
Alignment:
| Q |
29 |
agcaaccacagtggcttctcttcaaacttcagtgtcactgtcagcttcttattcttcaacttctacaactactaattttgcnnnnnnnnnnnnnnnnnnn |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626792 |
agcaaccacagtggcttctcttcaaacttcagtgtcactgtcagcttcttattcttcaacttctacaactactaattttgcctttttttttttttttttt |
38626693 |
T |
|
| Q |
129 |
nnggaccaaattttgattcttcttttatttctccaatttaatggccttcgggtttaattttattcttcaatttcgttatggacaannnnnnnatgttatt |
228 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||| |
|
|
| T |
38626692 |
ttggactaaattttgattcttcttttagttctccaatttaatggccttcgggtttaatcttattcttcaatttcattatggacaattgtttaatgttatt |
38626593 |
T |
|
| Q |
229 |
cctcaccaacccagttagcaacatttc |
255 |
Q |
| |
|
|||||||||| |||| ||||||||||| |
|
|
| T |
38626592 |
cctcaccaacacagtgagcaacatttc |
38626566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 40 - 109
Target Start/End: Complemental strand, 38652926 - 38652857
Alignment:
| Q |
40 |
tggcttctcttcaaacttcagtgtcactgtcagcttcttattcttcaacttctacaactactaattttgc |
109 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
38652926 |
tggcttctcttcaaacttcagtgtcaccgtcagcttcttattcttcaagttatacaactactacttttgc |
38652857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 123 times since January 2019
Visitors: 6713