View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_high_36 (Length: 252)
Name: NF0918_high_36
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_high_36 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 9417994 - 9417736
Alignment:
Q |
7 |
tcgaagaatatgcatgggtttggtt-cattggcttaatttactattgtaatttctttgcttgtgagacgcgtcttcacatgcaaatttagtggcaagtaa |
105 |
Q |
|
|
|||||| | |||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
9417994 |
tcgaaggaaatgcatgggtttggtttcattggcttaatttactattgt---ttctttgcttgtgagacgcgtcttcacatgcaaatttagtgccaagtaa |
9417898 |
T |
 |
Q |
106 |
agtacaagtttattgttgactgactcaaatggagcagccacaatt---------------aattattacactcatgtccacattctcaaagttgactccg |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9417897 |
agtacaagtttattgttgactgactcaaatggagcacccacaattatttataattaagtaaattattacactcatgtccacattctcaaagttgactccg |
9417798 |
T |
 |
Q |
191 |
accaacgtgtatatcctcgtgggaagtgaaacccatcctcttgagggtggtaaatatttttt |
252 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
9417797 |
accaacgtgtatatcctcgtgggaagtggaacccatcctcttgagggtggtaaatatttttt |
9417736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 668 times since January 2019
Visitors: 6718