View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_15 (Length: 447)
Name: NF0918_low_15
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 8e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 170 - 324
Target Start/End: Original strand, 38298531 - 38298684
Alignment:
| Q |
170 |
tagtttttatggcacttagattttgcgaaaaaataggtgtctaaacgttaaaaaatagaaagnnnnnnnacttgaagcaatttgcatttcaattctcttt |
269 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38298531 |
tagtttttatgacacttagattttgcgaaaaaataggtgtctaaacgttaaaaaatagaaagtttttt-acttgaagcaatttgcatttcaattctcttt |
38298629 |
T |
 |
| Q |
270 |
ctttccttctttgaaacacaaaacttgcaatccttgattaatatatatatatacc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38298630 |
ctttccttctttgaaacacaaaacttgcaatccttgattaatatctatatatacc |
38298684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 38298370 - 38298487
Alignment:
| Q |
1 |
atctatctatctatcttgcttcatttctatgtttgtttcttaaacattgaacaaagtagatttcttttgagttttcttcaagccttagacatagcgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38298370 |
atctatctatctatcttgcttcatttctatgtttgtttcttaaacattgaacaaagtagatttcttttgagttttcttcaagccttagacatagcgtgtg |
38298469 |
T |
 |
| Q |
101 |
ttgaatccacaacattgt |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38298470 |
ttgaatccacaacattgt |
38298487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University