View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_18 (Length: 427)
Name: NF0918_low_18
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 4e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 125 - 282
Target Start/End: Complemental strand, 6289799 - 6289642
Alignment:
Q |
125 |
atgcatatcaaatttcatacgtaccttgagttcgtagcgcctattaaagaaaaggcagatcccaaagtgtttgaagagcatatccttatcatcatagggc |
224 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6289799 |
atgcacatcaaatttcatacgtaccttgagttcgtagcgcctattaaagaaaaggcagatcccaaagtgtttgaagagcatatccttatcatcatagggc |
6289700 |
T |
 |
Q |
225 |
aaccttggaacaatgtcattgcaataaacaaacctacaataggttatacgattttcct |
282 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
6289699 |
aaccttggaacaatgtcattgcaataaacaaacctgcaataggttatacgattttcct |
6289642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 128 times since January 2019
Visitors: 6713