View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_22 (Length: 400)
Name: NF0918_low_22
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 89 - 376
Target Start/End: Original strand, 10816994 - 10817281
Alignment:
| Q |
89 |
aaggtgaggaagattgttaaattccagttctaaaggttttcactagttcagtgtaagcatttcaaagtaaggcatttattcctgatggtcaatatagtgt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10816994 |
aaggtgaggaagattgttaaattccagttctaaaggttttcactagttcagtgtaagcatttcaaagtaaggcatttattcctgatggtcaatatagtgt |
10817093 |
T |
|
| Q |
189 |
tgatgtcgcaaccatttcttttaagtgattcgtagtccactgcactctggataattagactcaaatcttctctatgagtgttcatcattttggtttgatg |
288 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10817094 |
tgatgtcgcaaccattccttttaagtgattcgtagtccactgcactctggataattagactcaaatcttctctatgagtgttcatcattttggtttgatg |
10817193 |
T |
|
| Q |
289 |
aataacgttgcttcagattgcatagacatagcagcctgagaagatgtagaagttccgtccatgatcaaaggttctaaggattttgtac |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10817194 |
aataacgttgcttcagattgcatagacatagcagcctgagaagatgtagaagttccgtccatgatcaaaggttctaaggattttgtac |
10817281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1251 times since January 2019
Visitors: 6711