View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_34 (Length: 343)
Name: NF0918_low_34
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 100 - 334
Target Start/End: Original strand, 17319792 - 17320027
Alignment:
Q |
100 |
aatatatctccttgtatcttctatgagtggagttggaacccgaacgagtgcttaaaaagatgatttgggtgcggtgtttggctcacccagtccatggaat |
199 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17319792 |
aatatatctccctgtatcttctatgagtggagttggaacccgaacgagtgcttaaaaagatgatttgggtgcggtgtttggctcacccagtccatggaat |
17319891 |
T |
 |
Q |
200 |
ttagcttttgctagagggactaacttatcctttggtttggccttctg-tttgtttatgtcgggtgttttgaacataactgtgtttctgtggagttatatc |
298 |
Q |
|
|
|||||||||||||| | ||||||||||||||||| |||||||||||| ||| ||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
T |
17319892 |
ttagcttttgctagggagactaacttatcctttgttttggccttctgttttttttatgtcgggtgttctgaacgtaactgtgtttctgtggagttatatc |
17319991 |
T |
 |
Q |
299 |
cctttattagcaggtttttgtgtgcttgtttctttt |
334 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| |
|
|
T |
17319992 |
cctttattagcaggtttttgtctgcttgtttctttt |
17320027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University