View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_35 (Length: 338)
Name: NF0918_low_35
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 98 - 310
Target Start/End: Complemental strand, 44614559 - 44614347
Alignment:
| Q |
98 |
ccttaacctcggtctccttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactttttgtccattgca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44614559 |
ccttaacctcggtctccttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaattgcctctcttctactttttgtccattgca |
44614460 |
T |
 |
| Q |
198 |
ttcctcaaatgannnnnnnaacgatgcaagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctggccttttatttatattcaacgaagga |
297 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44614459 |
ttcctcaaatgatttttttaacgatgcaagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctgaccttttatttatattcaacgaagga |
44614360 |
T |
 |
| Q |
298 |
atatcatcttcat |
310 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44614359 |
atatcatcttcat |
44614347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 98 - 293
Target Start/End: Complemental strand, 44623705 - 44623510
Alignment:
| Q |
98 |
ccttaacctcggtctccttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactttttgtccattgca |
197 |
Q |
| |
|
||||||| | ||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
44623705 |
ccttaacttgggtctccatattttctagctcttcgcagcacttctcaatatctctctttatagaccgcaatcgcctctcttctacttgttgtccgttgca |
44623606 |
T |
 |
| Q |
198 |
ttcctcaaatgannnnnnnaacgatgcaagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctggccttttatttatattcaacga |
293 |
Q |
| |
|
|||| | ||||| |||||||||||||||||||||||| |||||||||| ||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
44623605 |
ttccgcgaatgatttttttaacgatgcaagttctttcctcagcatggaaaatgaattatcagctgattttcctggctttttatttatgttcaacga |
44623510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 221 - 310
Target Start/End: Complemental strand, 39601951 - 39601862
Alignment:
| Q |
221 |
atgcaagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctggccttttatttatattcaacgaaggaatatcatcttcat |
310 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||| |||||||| |||||||||| ||| || |||| |||||||||||||||||| |
|
|
| T |
39601951 |
atgcaaggcctttcttcagcgaggaaaatgatttatcagttgatttgcttggccttttaattaaatccaacaaaggaatatcatcttcat |
39601862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 114 - 184
Target Start/End: Original strand, 39422491 - 39422561
Alignment:
| Q |
114 |
cttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactt |
184 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||| ||| ||||| | |||||||||||| |
|
|
| T |
39422491 |
cttattttccagctctttgcagcacttctcaatatctctctttatggactgcaatatcttctcttctactt |
39422561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 39136351 - 39136281
Alignment:
| Q |
114 |
cttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactt |
184 |
Q |
| |
|
||||||||| || |||| |||||| | |||||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
39136351 |
cttattttcaagatcttcgcagcactcctcaatatctctctttatggactgcaatctcctctcttctactt |
39136281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 310
Target Start/End: Complemental strand, 39214820 - 39214733
Alignment:
| Q |
223 |
gcaagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctggccttttatttatattcaacgaaggaatatcatcttcat |
310 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||| | ||||||||||||||||||| ||| || | || || ||||||||||||||| |
|
|
| T |
39214820 |
gcaaggtctttcttcagcgaggaaaatgatttatgggttgatttgcctggccttttaattaaatccgacaaaagaatatcatcttcat |
39214733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 39458275 - 39458209
Alignment:
| Q |
118 |
ttttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactt |
184 |
Q |
| |
|
||||| || ||||||||||| | |||||||||||||||||| ||| |||||| | |||||||||||| |
|
|
| T |
39458275 |
ttttcaagatctttgcagcactcctcaatatctctctttatggactgcaatctcttctcttctactt |
39458209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 180
Target Start/End: Complemental strand, 39129551 - 39129487
Alignment:
| Q |
116 |
tattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttct |
180 |
Q |
| |
|
||||||| ||||||||| |||| | |||||||||||||||||| ||| |||||| | |||||||| |
|
|
| T |
39129551 |
tattttcaagctctttggagcactcctcaatatctctctttatggactgcaatctcttctcttct |
39129487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 39151968 - 39151898
Alignment:
| Q |
114 |
cttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactt |
184 |
Q |
| |
|
||||||||| ||||||||| ||| || |||||||| ||||||||| ||| ||| || | |||||||||||| |
|
|
| T |
39151968 |
cttattttcaagctctttggagcgttcctcaatatttctctttattgactgcagtctcttctcttctactt |
39151898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 39161046 - 39160992
Alignment:
| Q |
225 |
aagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctggcctttta |
279 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
39161046 |
aagttctttcatcagcgaggaaaatgattcatcagctgatttgcttggcttttta |
39160992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 39208148 - 39208202
Alignment:
| Q |
225 |
aagttctttcctcagcgaggaaaatgaaatatcagctgatttgcctggcctttta |
279 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
39208148 |
aagttctttcatcagcgaggaaaatgattcatcagctgatttgcttggcttttta |
39208202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 114 - 184
Target Start/End: Original strand, 39488192 - 39488262
Alignment:
| Q |
114 |
cttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactt |
184 |
Q |
| |
|
||||||||| |||||||| |||| | ||||| |||||||||||||||| ||| || || ||||||||||| |
|
|
| T |
39488192 |
cttattttcaagctctttagagcactcctcaacatctctctttatagactgcagtctcccctcttctactt |
39488262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 108 - 209
Target Start/End: Original strand, 44951378 - 44951476
Alignment:
| Q |
108 |
ggtctccttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactttttgtccattgcattcctcaaat |
207 |
Q |
| |
|
||||||||||||||| ||||||| |||||| |||| ||||||||||||||| | ||||||| ||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
44951378 |
ggtctccttattttcaagctcttcgcagcacttcttaatatctctctttatcggccgcaattgcctctcttctac---ttgcccgttgcattcctcaaat |
44951474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 99 - 200
Target Start/End: Complemental strand, 40347351 - 40347250
Alignment:
| Q |
99 |
cttaacctcggtctccttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactttttgtccattgcat |
198 |
Q |
| |
|
|||||| | ||||||| ||||||||||||||||||| || ||||||| | || |||| || ||||||||||||||| ||| ||||| ||||| ||||||| |
|
|
| T |
40347351 |
cttaacttgggtctccatattttctagctctttgcaacacttctcaacagctttcttaatggaccgcaatcgcctcacttttacttgttgtctattgcat |
40347252 |
T |
 |
| Q |
199 |
tc |
200 |
Q |
| |
|
|| |
|
|
| T |
40347251 |
tc |
40347250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 19806712 - 19806642
Alignment:
| Q |
114 |
cttattttctagctctttgcagcatttctcaatatctctctttatagaccgcaatcgcctctcttctactt |
184 |
Q |
| |
|
||||||||| || |||| |||||| | |||||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
19806712 |
cttattttcaagatcttcgcagcaatcctcaatatctctctttatggactgcaatctcctctcttctactt |
19806642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 142 - 182
Target Start/End: Complemental strand, 17058883 - 17058843
Alignment:
| Q |
142 |
tcaatatctctctttatagaccgcaatcgcctctcttctac |
182 |
Q |
| |
|
||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
17058883 |
tcaatatctctctttatagactgcaatcgcttttcttctac |
17058843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University