View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0918_low_39 (Length: 314)

Name: NF0918_low_39
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0918_low_39
NF0918_low_39
[»] scaffold0175 (1 HSPs)
scaffold0175 (6-260)||(32818-33072)


Alignment Details
Target: scaffold0175 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0175
Description:

Target: scaffold0175; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 260
Target Start/End: Complemental strand, 33072 - 32818
Alignment:
6 agaaacaaaggcacaataggagggagataaacgatgatatgacaagaaattataaatagggtaaggattacgggttgaacggttacatttacggatggga 105  Q
    ||||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33072 agaaacaaaagcacaataggcggaagataaacgatgatatgacaagaaattataaatagggtaaggattacgggttgaacggttacatttacggatggga 32973  T
106 agggtcatatcaggagatggagatggagacgcagatcgatccggagtagggtacgaaacacttggaacaggaactgaagcatgtggttcaacccttctct 205  Q
    | |||||||||||||||||||||||||||||||||||  |||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||    
32972 atggtcatatcaggagatggagatggagacgcagatcattccggagtaggggacgaaacacttggaataggaattgaagcatgtggttcaacccttctct 32873  T
206 cataagtgatgccatactagttaataggtggaggagagttggttggagatgatgt 260  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
32872 cataagtgatgccataccagttaataggtggaggagagttggttggagatgatgt 32818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University