View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_45 (Length: 275)
Name: NF0918_low_45
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 4 - 210
Target Start/End: Original strand, 38298155 - 38298366
Alignment:
| Q |
4 |
attgccgtgtatccaatccataaccccccatctcctctgtttctcatcagttacaatcacaattctcggtttcatctagctacatacacacaccttc--- |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38298155 |
attgccgtgtatccaatccataaccccccatctcctctgtttctcatcagttacaatcacaattctcggtttcatctagctacatacacacaccttctct |
38298254 |
T |
|
| Q |
101 |
--tcttctcttctctttttagttttcgtgtccattttctcaggaaaagccaccctacttttccgttaaacaccgtccacttttaacgctccttaagtttc |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38298255 |
tctcttctcttctcttcttagttttcgtgtccattttctcaggaaaagccaccctacttttccgttaaacaccgtccacttttaacgctccttaagtttc |
38298354 |
T |
|
| Q |
199 |
aaacgtgaatac |
210 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38298355 |
aaacgtgaatac |
38298366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 633 times since January 2019
Visitors: 6718