View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_47 (Length: 262)
Name: NF0918_low_47
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 190 - 246
Target Start/End: Original strand, 25520388 - 25520444
Alignment:
Q |
190 |
aatctcaatatatttaccatgatgaaataattgagctgttccacttcaatctctgtc |
246 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25520388 |
aatctcaatatatttaccatgatgaaataattgagctgttccacttcaatctctgtc |
25520444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 69 - 185
Target Start/End: Complemental strand, 42141783 - 42141666
Alignment:
Q |
69 |
atagattttctcttctccaattattttcttcctattttgtctagacattacataccacaaaaaattcaag--aatgaggccaacataccttattcatata |
166 |
Q |
|
|
|||| |||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||| || || ||||| ||||| |||||||||||||| |
|
|
T |
42141783 |
atagtttttctcttctccaattattttattcctattttgtctagaca-tacataacacaaaaactttgagaaaatgacaccaacctaccttattcatatg |
42141685 |
T |
 |
Q |
167 |
tgtaatcataacaactatt |
185 |
Q |
|
|
|| |||||||||||||||| |
|
|
T |
42141684 |
tgcaatcataacaactatt |
42141666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 42133433 - 42133397
Alignment:
Q |
194 |
tcaatatatttaccatgatgaaataattgagctgttc |
230 |
Q |
|
|
|||||||| | |||||||||||||||||||||||||| |
|
|
T |
42133433 |
tcaatatactaaccatgatgaaataattgagctgttc |
42133397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University