View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_49 (Length: 261)
Name: NF0918_low_49
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 146
Target Start/End: Original strand, 6976585 - 6976629
Alignment:
Q |
102 |
atgtaggttggatatcgtcatatagattgtgctcaatattatggc |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6976585 |
atgtaggttggatatcgtcatatagattgtgctcaatattatggc |
6976629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 146
Target Start/End: Original strand, 6957129 - 6957169
Alignment:
Q |
106 |
aggttggatatcgtcatatagattgtgctcaatattatggc |
146 |
Q |
|
|
||||||| |||||||||||||||||||||||| ||||||| |
|
|
T |
6957129 |
aggttggttatcgtcatatagattgtgctcaaatttatggc |
6957169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University