View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0918_low_49 (Length: 261)

Name: NF0918_low_49
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0918_low_49
NF0918_low_49
[»] chr4 (2 HSPs)
chr4 (102-146)||(6976585-6976629)
chr4 (106-146)||(6957129-6957169)


Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 146
Target Start/End: Original strand, 6976585 - 6976629
Alignment:
102 atgtaggttggatatcgtcatatagattgtgctcaatattatggc 146  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
6976585 atgtaggttggatatcgtcatatagattgtgctcaatattatggc 6976629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 146
Target Start/End: Original strand, 6957129 - 6957169
Alignment:
106 aggttggatatcgtcatatagattgtgctcaatattatggc 146  Q
    ||||||| ||||||||||||||||||||||||  |||||||    
6957129 aggttggttatcgtcatatagattgtgctcaaatttatggc 6957169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University