View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0918_low_51 (Length: 258)

Name: NF0918_low_51
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0918_low_51
NF0918_low_51
[»] chr5 (2 HSPs)
chr5 (30-258)||(7450020-7450248)
chr5 (41-102)||(4477406-4477467)
[»] chr4 (1 HSPs)
chr4 (50-103)||(3982885-3982938)
[»] scaffold0034 (1 HSPs)
scaffold0034 (47-95)||(8859-8907)
[»] chr1 (1 HSPs)
chr1 (43-103)||(8019188-8019248)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 7450020 - 7450248
Alignment:
30 cattgttgttcgtgtgctccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttggactggttctctagccgtcctaagcacc 129  Q
    |||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
7450020 cattgttgttcgtgtgctccttgaggcgatgcaccttagtttgatggacgttcggtccacgtgtcaatgttggactggttctctagccgtcctaagcacc 7450119  T
130 atccaatcaccaatatgctccatttaattgattcgttgacccacatattatccagaaagccaaatcataaagtttgatcagggtgtgcttgagaaccacg 229  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
7450120 atccaatcaccaatatgctccatttaattgattcgttgacgcacatattatccagagagccaaatcataaagtttgatcagggtgtgcttgagaaccacg 7450219  T
230 aaacaatccatgacataaagtttaaaata 258  Q
    |||||||||||||||||||||||||||||    
7450220 aaacaatccatgacataaagtttaaaata 7450248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 41 - 102
Target Start/End: Original strand, 4477406 - 4477467
Alignment:
41 gtgtgctccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgg 102  Q
    ||||||||||| ||  ||||| |||| | ||| |||||||||||||||||||||| ||||||    
4477406 gtgtgctccttgagttgatgcgccttggcctggtggacgttcgatccacgtgtcagtgttgg 4477467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 50 - 103
Target Start/End: Original strand, 3982885 - 3982938
Alignment:
50 ttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgga 103  Q
    ||||||||||| |||||||| ||||||||||| | ||||| |||||| ||||||    
3982885 ttcaggcgatgtaccttagtttgatggacgtttggtccacatgtcaacgttgga 3982938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 95
Target Start/End: Complemental strand, 8907 - 8859
Alignment:
47 tccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtca 95  Q
    ||||||||||||||||||||||| || ||| |||| ||||||| |||||    
8907 tccttcaggcgatgcaccttagtatggtgggcgtttgatccacatgtca 8859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 103
Target Start/End: Original strand, 8019188 - 8019248
Alignment:
43 gtgctccttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgga 103  Q
    ||||||||||| ||||||| |||| ||||| |||||||| | | ||||||||| |||||||    
8019188 gtgctccttcaagcgatgcgccttggtctggtggacgtttggttcacgtgtcagtgttgga 8019248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University