View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_52 (Length: 257)
Name: NF0918_low_52
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0918_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 39044663 - 39044436
Alignment:
Q |
1 |
ccagtacgactgctggaacagcctgaaatacgccaacgacactcacgccgtcggtgaagctatgtcgtttatcgattcccttgagacgctcactagtaac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39044663 |
ccagtacgactgctggaacagcctgaaatacgccaacgacactcacgccgtcggtgaagctatgtcgtttatcgattcccttgagacgctcactagtaac |
39044564 |
T |
 |
Q |
101 |
gctcttgccatggcgttttcctacgacgtttatggcaaagacacgtcgttgtggaagccgcctaccaccgagcgcgacggtttatggcaggccactggat |
200 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39044563 |
gcccttgccatggcgttttcctacgacgtttatggcaaagacacgtcgttttggaagccgcctaccaccgagcgcgacggtttatggcaggccactggat |
39044464 |
T |
 |
Q |
201 |
cgggcggaggatcggtgtctagcatagg |
228 |
Q |
|
|
||||||||||||||||||||||| |||| |
|
|
T |
39044463 |
cgggcggaggatcggtgtctagcgtagg |
39044436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 66 times since January 2019
Visitors: 6713