View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0918_low_62 (Length: 212)
Name: NF0918_low_62
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0918_low_62 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 29 - 212
Target Start/End: Original strand, 26375037 - 26375221
Alignment:
| Q |
29 |
atcggatacattatagtttatctgcttgttttgatgtgtttagacgt-caacagagcaaatatttttaacatatgaaagtttaatcatcattatatgttc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375037 |
atcggatacattatagtttatctgcttgttttgatgtgcttagacgttcaacagagcaaatatttttaacatatgaaagtttaatcatcattatatgttc |
26375136 |
T |
 |
| Q |
128 |
atgattacaaaatgtcctttcttcacttgatagttggcaccaatgatttaactttacaacatgaattttgaagcaagataaaaag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375137 |
atgattacaaaatgtcctttcttcacttgatagttggcaccaatgatttaactttacaacatgaattttgaagcaagataaaaag |
26375221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University