View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0918_low_62 (Length: 212)

Name: NF0918_low_62
Description: NF0918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0918_low_62
NF0918_low_62
[»] chr2 (1 HSPs)
chr2 (29-212)||(26375037-26375221)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 29 - 212
Target Start/End: Original strand, 26375037 - 26375221
Alignment:
29 atcggatacattatagtttatctgcttgttttgatgtgtttagacgt-caacagagcaaatatttttaacatatgaaagtttaatcatcattatatgttc 127  Q
    |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
26375037 atcggatacattatagtttatctgcttgttttgatgtgcttagacgttcaacagagcaaatatttttaacatatgaaagtttaatcatcattatatgttc 26375136  T
128 atgattacaaaatgtcctttcttcacttgatagttggcaccaatgatttaactttacaacatgaattttgaagcaagataaaaag 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26375137 atgattacaaaatgtcctttcttcacttgatagttggcaccaatgatttaactttacaacatgaattttgaagcaagataaaaag 26375221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 45 times since January 2019
Visitors: 6713