View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_high_17 (Length: 224)
Name: NF0919_high_17
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0919_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 44 - 213
Target Start/End: Original strand, 4815139 - 4815309
Alignment:
| Q |
44 |
ctctctgtcctataacactttttccgtctctctcccttagcactctctgccca-gaaccctcaattcgtccaaattctctcctgcagaacagatttgaaa |
142 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| |||||||||||||| ||||||| ||||| ||||||||||||| |||| |||| |||||||| |
|
|
| T |
4815139 |
ctctctgtcctagaacacttttttcgtctctctcccttggcactctctgcccaagaaccctaaattcttccaaattctctcttgcacaacatatttgaaa |
4815238 |
T |
|
| Q |
143 |
ttgaaattgatatttggggttcaagtaattaggttgctctctctttttcaaattcgtttttatggttctct |
213 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
4815239 |
ttgaaattgatatttggggttcaagtatttaggttgctcactctttttcaaattcgtttgtatggttctct |
4815309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 44 - 201
Target Start/End: Original strand, 23486095 - 23486253
Alignment:
| Q |
44 |
ctctctgtcctataacactttttccgtctctctcccttagcactctctgccca-gaaccctcaattcgtccaaattctctcctgcagaacagatttgaaa |
142 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||| |||||||||||||| ||||||| ||||| || |||||||||| |||| |||| |||||||| |
|
|
| T |
23486095 |
ctctctgtcctagaacatttttttcgtctctctcccttggcactctctgcccaagaaccctaaattcttcgaaattctctcttgcacaacatatttgaaa |
23486194 |
T |
|
| Q |
143 |
ttgaaattgatatttggggttcaagtaattaggttgctctctctttttcaaattcgttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
23486195 |
ttgaaattgatatttggggttcaagtatttaggttgctcactctttttcaaattcgttt |
23486253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 44 - 212
Target Start/End: Original strand, 23517448 - 23517623
Alignment:
| Q |
44 |
ctctctgtcctataacactttttccgtctctctcccttagcactctctgccc-agaaccctcaattcgtccaaattctctcctgcagaacagatttgaaa |
142 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| ||||||||||||| |||||||| ||||| ||||||||||||| |||| |||| |||||||| |
|
|
| T |
23517448 |
ctctctgtcctagaacacttttttcgtctctctcccttggcactctctgcccaagaaccctaaattcttccaaattctctcttgcacaacatatttgaaa |
23517547 |
T |
|
| Q |
143 |
ttgaa------attgatatttggggttcaagtaattaggttgctctctctttttcaaattcgtttttatggttctc |
212 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||| |
|
|
| T |
23517548 |
ttgaaattgatattgatatttggggttcaagtatttaggttgctcactctttttcaaattcgtttgtacggttctc |
23517623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 104 times since January 2019
Visitors: 6713