View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_high_5 (Length: 441)
Name: NF0919_high_5
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0919_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 1e-66; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 266 - 431
Target Start/End: Original strand, 4150693 - 4150858
Alignment:
Q |
266 |
ttgctgaaaaagtcacccttggcaaaggctgagatcatagacttgacaaggtaaatatgcattaaacttttaagaacnnnnnnncattctgatttggcct |
365 |
Q |
|
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
T |
4150693 |
ttgctgcaaaagtcacccttagcaaaggctgagatcatagacttgacaaggtaaatatgcattaaacttttcagaactttttttcattctgatttggcct |
4150792 |
T |
 |
Q |
366 |
ttttgttttatttcccttagtctctcttgttatgaaatgtctgtagatacattacaactctctctg |
431 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4150793 |
ttttgttttatttcccttggtctctcttgttatgaaatgtctgtagatacattacaactctctctg |
4150858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 266 - 431
Target Start/End: Original strand, 4166462 - 4166627
Alignment:
Q |
266 |
ttgctgaaaaagtcacccttggcaaaggctgagatcatagacttgacaaggtaaatatgcattaaacttttaagaacnnnnnnncattctgatttggcct |
365 |
Q |
|
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
T |
4166462 |
ttgctgcaaaagtcacccttagcaaaggctgagatcatagacttgacaaggtaaatatgcattaaacttttcagaactttttttcattctgatttggcct |
4166561 |
T |
 |
Q |
366 |
ttttgttttatttcccttagtctctcttgttatgaaatgtctgtagatacattacaactctctctg |
431 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4166562 |
ttttgttttatttcccttggtctctcttgttatgaaatgtctgtagatacattacaactctctctg |
4166627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 154 - 275
Target Start/End: Original strand, 4150524 - 4150645
Alignment:
Q |
154 |
aaaacatgacttgctttaaattgatcatgattcaccctccctcattgtatagactctttgcttagttcctggtttatggaaggttgatttcccttactta |
253 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
4150524 |
aaaacatgacttgccttaaactgatcatgattcaccctccctcgttgcatagactctttgctcagttcctggtttatggaaggttgatttcccttactta |
4150623 |
T |
 |
Q |
254 |
caaaacttgaaattgctgaaaa |
275 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
4150624 |
caaaacttgaaattgctgaaaa |
4150645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 154 - 275
Target Start/End: Original strand, 4166293 - 4166414
Alignment:
Q |
154 |
aaaacatgacttgctttaaattgatcatgattcaccctccctcattgtatagactctttgcttagttcctggtttatggaaggttgatttcccttactta |
253 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
4166293 |
aaaacatgacttgccttaaactgatcatgattcaccctccctcgttgcatagactctttgctcagttcctggtttatggaaggttgatttcccttactta |
4166392 |
T |
 |
Q |
254 |
caaaacttgaaattgctgaaaa |
275 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
4166393 |
caaaacttgaaattgctgaaaa |
4166414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 4150400 - 4150452
Alignment:
Q |
30 |
tcttcatctactcttgaggtacttcagtgactattggtttaggaaaaacatag |
82 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4150400 |
tcttcatctattcttgaggtacttcagtgactattggtttaggaaaaacatag |
4150452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 4166169 - 4166221
Alignment:
Q |
30 |
tcttcatctactcttgaggtacttcagtgactattggtttaggaaaaacatag |
82 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4166169 |
tcttcatctattcttgaggtacttcagtgactattggtttaggaaaaacatag |
4166221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 124 times since January 2019
Visitors: 6702