View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_16 (Length: 363)
Name: NF0919_low_16
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0919_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 80 - 262
Target Start/End: Original strand, 31996925 - 31997106
Alignment:
| Q |
80 |
atcatagggtgaagctatattgttttacaatgactattttttgcaaactattttctgtatattatttcttacttactcaaatctctctgatattgatatg |
179 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31996925 |
atcaaagggtgaagctatattgttttacaatgactattttttgcaaactattttctgtatattatttcttacatactcaaatctctctgatattgatatg |
31997024 |
T |
|
| Q |
180 |
ttgttatttcttgtgctagagttattttctgattaaggcaagtttagaccttacagtatgcacaacaattattcggtatacaa |
262 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31997025 |
ttgttatttcttttgctaga-ttactttctgattaaggcaagtttagaccttacagtatgcacagcaattattcggtatacaa |
31997106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 24011575 - 24011622
Alignment:
| Q |
193 |
tgctagagttattttctgattaaggcaagtttagaccttacagtatgca |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||| || ||||| |
|
|
| T |
24011575 |
tgctagagttattt-ctgattaaggcaagtttagactttagagaatgca |
24011622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1456 times since January 2019
Visitors: 6712