View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0919_low_21 (Length: 328)

Name: NF0919_low_21
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0919_low_21
NF0919_low_21
[»] chr4 (1 HSPs)
chr4 (183-259)||(26480325-26480397)


Alignment Details
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 259
Target Start/End: Complemental strand, 26480397 - 26480325
Alignment:
183 acgcacaatatattagtatatattttagtgccaaccaattgttctgcaattgatagaaattaatatcactgcctatg 259  Q
    |||||||||||||||||||    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
26480397 acgcacaatatattagtat----tttagtgccaaccaattgttcagcaattgatagaaattaatatcactgcctatg 26480325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University