View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_24 (Length: 322)
Name: NF0919_low_24
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0919_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 114 - 266
Target Start/End: Original strand, 3129125 - 3129281
Alignment:
Q |
114 |
ggattgatgtattgttattattatcggtgtttgtgtttgtgtaatagtat----tatagggatctgagacaaagctttctgagccacttctgatagaaac |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3129125 |
ggattgatgtattgttattattatcggtgtttgtgtttgtgtaatagtatgtattatagggatctgagacaaagctttctgagccacttctgatagaaac |
3129224 |
T |
 |
Q |
210 |
aaagattttacatgcgcagagaaagagggagaatcaaaagcatttatttattttaaa |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3129225 |
aaagattttacatgcgcagagaaagagggagaatcaaaagcatttatttattttaaa |
3129281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 184 times since January 2019
Visitors: 6702