View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_25 (Length: 321)
Name: NF0919_low_25
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0919_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 89 - 203
Target Start/End: Complemental strand, 5257943 - 5257829
Alignment:
| Q |
89 |
tatagtgcaaaaaggggggtgtgaatggttgattaaagatgctttagatttgtatttcaaatttatgatctccgagtagagatctcagacacgacacctt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| |
|
|
| T |
5257943 |
tatagtgcaaaaaggggggtgtgaatggttgattaaaaaatctttagatttgtatttcaaattaatgatctccgagtagaattctcagacacgtcacctt |
5257844 |
T |
 |
| Q |
189 |
gtttcatagatttta |
203 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5257843 |
gtttcatagatttta |
5257829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University