View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_35 (Length: 267)
Name: NF0919_low_35
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0919_low_35 |
 |  |
|
[»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 267
Target Start/End: Complemental strand, 34231535 - 34231277
Alignment:
Q |
9 |
gaaaagaatccggcatttgaccactgagtacattgtcatcgagatacagaaaggtaagatgtgaaaaggttaaaattgtggatggaattgaaccatttag |
108 |
Q |
|
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
34231535 |
gaaaagaatccgggatttgaccattgagtacattgtcatcgagatacagaaaggtaagatgtgaaaaggttaaaattgtggatggaattgaaccgtttag |
34231436 |
T |
 |
Q |
109 |
gtggttccctgacagacgtagggaagcaagacgtgtaaggttagaaaaagacagaggaattgatccttggaatccacaacctgagagatccaaggtaatg |
208 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
T |
34231435 |
gtggttccctgacagacgtagggaggcaagacgtgtaaggttagaaaaagacagaggaattgacccttggaatccacaacctgagagatccaaagtaatg |
34231336 |
T |
 |
Q |
209 |
agagaagtactgcagctcatatctggaagttggccttcaaggtggtcattatgtgacat |
267 |
Q |
|
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
T |
34231335 |
agagaagtactacagctcaattctggaagttggccttcaaggtggtcattatatgacat |
34231277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 88 - 251
Target Start/End: Complemental strand, 41570658 - 41570495
Alignment:
Q |
88 |
ggatggaattgaaccatttaggtggttccctgacagacgtagggaagcaagacgtgtaaggttagaaaaagacagaggaattgatccttggaatccacaa |
187 |
Q |
|
|
|||||| ||||||||||| |||| |||| || |||| |||||||| || | ||| |||||||| ||||| |||||||||| |||| |||| |||| |
|
|
T |
41570658 |
ggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaagaaagaggaattggccctttgaatagacaa |
41570559 |
T |
 |
Q |
188 |
cctgagagatccaaggtaatgagagaagtactgcagctcatatctggaagttggccttcaaggt |
251 |
Q |
|
|
||| ||||||||| | | |||||||| || ||||||| |||||||||||| |||||||||| |
|
|
T |
41570558 |
tatgaaagatccaagattctaagagaagtgctacagctcaaatctggaagttgaccttcaaggt |
41570495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 122 - 215
Target Start/End: Complemental strand, 34239318 - 34239225
Alignment:
Q |
122 |
agacgtagggaagcaagacgtgtaaggttagaaaaagacagaggaattgatccttggaatccacaacctgagagatccaaggtaatgagagaag |
215 |
Q |
|
|
|||| |||| ||| ||||||||| ||||| || ||||| ||||||| | ||||||| | ||||| ||| ||||||||||| ||||||||||| |
|
|
T |
34239318 |
agacttaggaaagtaagacgtgtgaggttggagaaagatggaggaataggcccttggagttcacaatctgtgagatccaaggaaatgagagaag |
34239225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 95 - 211
Target Start/End: Original strand, 12249789 - 12249905
Alignment:
Q |
95 |
attgaaccatttaggtggttccctgacagacgtagggaagcaagacgtgtaaggttagaaaaagacagaggaattgatccttggaatccacaacctgaga |
194 |
Q |
|
|
||||||||||| || ||||| |||| |||| || |||| |||| |||| | ||||||||| ||||||||||||| ||||||||||||||| |||||| |
|
|
T |
12249789 |
attgaaccattaagttggttttctgagagacttatggaattaagatgtgtgaagttagaaaaggacagaggaattggcccttggaatccacaatctgaga |
12249888 |
T |
 |
Q |
195 |
gatccaaggtaatgaga |
211 |
Q |
|
|
|||| |||||| ||||| |
|
|
T |
12249889 |
gatctaaggtagtgaga |
12249905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 395 times since January 2019
Visitors: 6714