View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_42 (Length: 248)
Name: NF0919_low_42
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0919_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 21 - 161
Target Start/End: Original strand, 16318447 - 16318587
Alignment:
| Q |
21 |
ccattgttattgctatccttcacaacatgttttttgtcagcaattagcaccactgataaaactagcacattttcaggtaactcactagctccttcaactt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16318447 |
ccattgttattgctatccttcacaacatgttttttgtcagcaattagcaccactgataaaactagcacattttcaggtaactcactagctccttcaactt |
16318546 |
T |
|
| Q |
121 |
caaaacctcgtaggtttgtctctaaactcatccaccctcat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16318547 |
caaaacctcgtaggtttgtctctaaactcatccaccctcat |
16318587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6 times since January 2019
Visitors: 6713