View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_43 (Length: 241)
Name: NF0919_low_43
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0919_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 14 - 97
Target Start/End: Complemental strand, 43083437 - 43083354
Alignment:
| Q |
14 |
tatatagtatatatactaagttttattatcaattaacgtgactaatctctatnnnnnnnnccgttacacacaagatgagttttt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
43083437 |
tatatagtatatatactaagttttattatcaattaacgtgactaatctctataaaaaaacctgttacacacaagatgagttttt |
43083354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 139 times since January 2019
Visitors: 6713