View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_50 (Length: 209)
Name: NF0919_low_50
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0919_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 7971426 - 7971548
Alignment:
Q |
1 |
caagcaattgtagagtaactgaaacacaaacataaaagatttaaattagcttgtttcaatccacaagttacttataaagagtgatgaaaataaaatgaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7971426 |
caagcaattgtagagtaactgaaacacaaacataaaagatttaaattagcttgtttcattccacaagttacttataaagagtgatgaaaataaaatgaaa |
7971525 |
T |
 |
Q |
101 |
tccaaaatacaaatttgagccta |
123 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
7971526 |
tccaaaatacaaatttgagccta |
7971548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 8042287 - 8042188
Alignment:
Q |
1 |
caagcaattgtagagtaactgaaacacaaacataaaagatttaaattagcttgtttc--aatccacaagttacttataaagagtgatgaaaataaaatga |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||| ||||| |||||||||||||| |
|
|
T |
8042287 |
caagcaattgtagagtaactgaaacacaaacataaaagatttaaattagcttgtttcatattccacaagttggatataatgagtggtgaaaataaaatga |
8042188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University