View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0919_low_52 (Length: 203)
Name: NF0919_low_52
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0919_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 48871137 - 48871080
Alignment:
Q |
1 |
ccatcccatgtaacattccatttagagaaacgccctaacaactgtccattgtcgtcat |
58 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
48871137 |
ccatcccatgtaacattccatttagagaaacgccctaacaactgtccattgtcatcat |
48871080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 48876441 - 48876384
Alignment:
Q |
1 |
ccatcccatgtaacattccatttagagaaacgccctaacaactgtccattgtcgtcat |
58 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
48876441 |
ccatcccatgtaacattccatttagagaaacgccctaacaactgtccattgtcatcat |
48876384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 48886823 - 48886766
Alignment:
Q |
1 |
ccatcccatgtaacattccatttagagaaacgccctaacaactgtccattgtcgtcat |
58 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
48886823 |
ccatcccatgtaacattccatttagagaaacgccctaacaactgtccattgtcatcat |
48886766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 57 times since January 2019
Visitors: 6713