View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_high_10 (Length: 301)
Name: NF0920_high_10
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0920_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 75 - 251
Target Start/End: Complemental strand, 15886089 - 15885913
Alignment:
| Q |
75 |
gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15886089 |
gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag |
15885990 |
T |
|
| Q |
175 |
agaggggtctccttgccttaaccctctaccagaaataaaaggaacaggtgtgctaccattaaacaaaatagaataat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15885989 |
agaggggtctccttgccttaaccctctaccaggaataaaaggtacaggtgtgctaccattaaacaaaatagaataat |
15885913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1042 times since January 2019
Visitors: 6709