View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_low_14 (Length: 352)
Name: NF0920_low_14
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0920_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 287
Target Start/End: Original strand, 42228526 - 42228802
Alignment:
| Q |
12 |
aagaaacttgtgacgcacataagatggattatct-cttccaaccaaattttttctatacgtatgactcaagaatcaaactcttgtccacgtacttaaacg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42228526 |
aagaaacttgtgacgcacataagatggactatcttcttccaaccaaattttttctatacgtatgactcaagaatcaaactcttgtccacgtacttaaacg |
42228625 |
T |
|
| Q |
111 |
gttctagtactatatcacttcattaatctattgttggtctagtaacatatttttatcaaacgtggggtgtcgatctcttttgtcctaaaccactagtatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42228626 |
gttctagtactatatcacttcattaatctattgttgatctagtaacatatttttatcaaacgtggcgtgtcgatctcttttgtcctaaaccactagtatg |
42228725 |
T |
|
| Q |
211 |
ttgtatcttgttgatttagataaatttcaaccaattctcataaacattcatttggtcgtcgtgcctaggcgccacat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
42228726 |
ttgtatcttgttgatttagataaatttcaatcaattcttataaacattcatttgatcgtcgtgcctagacgcgacat |
42228802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 265 - 346
Target Start/End: Original strand, 42228803 - 42228884
Alignment:
| Q |
265 |
gtcgtcgtgcctaggcgccacatacatggcgaaacacagtcctgctatgcttgactaaagtcatagcaattttagaccaaca |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42228803 |
gtcgtcgtgcctaggcgccacatacatggcgaaacacagtcctgctttgcttgactaaactcatagcaattttagacaaaca |
42228884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 950 times since January 2019
Visitors: 6707