View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_low_23 (Length: 279)
Name: NF0920_low_23
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0920_low_23 |
 |  |
|
[»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 14534554 - 14534374
Alignment:
Q |
1 |
ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatccgcacggcttggcgagagaattctgcatatcttatctatgattgtttttattt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14534554 |
ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatctgcacggcttggcgagagaattctgcatatcttatctatgattgtttttattt |
14534455 |
T |
 |
Q |
101 |
gccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc |
181 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14534454 |
gccatttcaaacctttttacggtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc |
14534374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 14530205 - 14530025
Alignment:
Q |
1 |
ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatccgcacggcttggcgagagaattctgcatatcttatctatgattgtttttattt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14530205 |
ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatctgcacgccttggcgagagaattctgcatatcttatctatgattgtttttattt |
14530106 |
T |
 |
Q |
101 |
gccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc |
181 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14530105 |
gccatttcaaacctctttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc |
14530025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 111 - 173
Target Start/End: Complemental strand, 14516994 - 14516932
Alignment:
Q |
111 |
acctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaat |
173 |
Q |
|
|
|||| ||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
14516994 |
acctctttactgtcttttatcaggccatgggtggtaattgaaaaacaagtaggtctcaaaaat |
14516932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 6 - 181
Target Start/End: Original strand, 37339917 - 37340092
Alignment:
Q |
6 |
tttgtaatttaacccacaatactttgaaaaaacttatgaatccgcacggcttggcgagagaattctgcatatcttatctatgattgtttttatttgccat |
105 |
Q |
|
|
||||||||||||||||||| |||| |||| || || ||| ||| | || ||||||| ||||||| |||| ||||||||||||||||| ||||||||| |
|
|
T |
37339917 |
tttgtaatttaacccacaacacttacaaaattattttggatctgcaagcctaggcgagataattctgtatatgttatctatgattgttttcatttgccat |
37340016 |
T |
 |
Q |
106 |
ttcaaacctttttaccgtctttt-ttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc |
181 |
Q |
|
|
|| |||||| || || ||||||| |||||||||||||||||||||||||||||||| || ||||||||| ||||||| |
|
|
T |
37340017 |
tt-aaacctcttcactgtctttttttcaggccatgggtggtaattgaaaaacaagtaggcctcaaaaatatcaaagc |
37340092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 78 - 181
Target Start/End: Original strand, 37328762 - 37328864
Alignment:
Q |
78 |
cttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtca |
177 |
Q |
|
|
||||| ||| |||||| | |||||||||| |||||| || || || ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
T |
37328762 |
cttatgtattattgttatcatttgccattg-aaacctcttcactgtattttttcaggccatgggtgataattgaaaaacaagtgggtctcaaaaatatca |
37328860 |
T |
 |
Q |
178 |
aagc |
181 |
Q |
|
|
|||| |
|
|
T |
37328861 |
aagc |
37328864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 157
Target Start/End: Original strand, 23347142 - 23347220
Alignment:
Q |
79 |
ttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaaca |
157 |
Q |
|
|
|||||||||||||| || |||| ||||| |||||| ||||| |||| |||||| |||||||||| ||||||||||||| |
|
|
T |
23347142 |
ttatctatgattgtattgattttgcatttgaaacctctttactgtctcttttcaagccatgggtgttaattgaaaaaca |
23347220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 157
Target Start/End: Complemental strand, 163504 - 163472
Alignment:
Q |
125 |
ttttttcaggccatgggtggtaattgaaaaaca |
157 |
Q |
|
|
|||||||| |||||||||||||||||||||||| |
|
|
T |
163504 |
ttttttcaagccatgggtggtaattgaaaaaca |
163472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 90 times since January 2019
Visitors: 6700