View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_low_26 (Length: 251)
Name: NF0920_low_26
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0920_low_26 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 3346212 - 3345972
Alignment:
| Q |
11 |
acaatataggatgatctttttgtatgagtatgtttggcattggttacatcaaccttaaattgaattatggaatgcaaagtttatccaaatgatattttac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
3346212 |
acaatataggatgatctttttgtatgagtatgtttggcattggttacatcaaccttaaattgaattatggaatgctaagtttatccaaatgctattttac |
3346113 |
T |
 |
| Q |
111 |
acaagttgtgtaaacttatcatacattgataatgatattgttcttttgttttttgaggtgaatgatatgtaatttttcttacggaaacaaactcaacttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3346112 |
acaagttgtgtaaacttatcatacattgataatgatattgttcttttgttttttgaggtgaatgatatgtaatttttcttacggaaacaaactcaacttg |
3346013 |
T |
 |
| Q |
211 |
tttcattaataacaacagtcaaaatataagatgacaattga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3346012 |
tttcattaataacaacagtcaaaatataagatgacaattga |
3345972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University