View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_30 (Length: 223)

Name: NF0920_low_30
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_30
NF0920_low_30
[»] chr7 (1 HSPs)
chr7 (1-142)||(25015266-25015409)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 25015409 - 25015266
Alignment:
1 ccttgtttatatttgaatcattgtttcatacaatttaattatgnnnnnnnnnnnnnnn--aatatttgattctggattgatttgattctgtttgctgatt 98  Q
    |||||||||||||||||||||||||||||||||||||||||||                 ||||||||||||||||||||||||||||||||||||||||    
25015409 ccttgtttatatttgaatcattgtttcatacaatttaattatgatttttttattttttttaatatttgattctggattgatttgattctgtttgctgatt 25015310  T
99 gttacttcaaatattgcagacaaattgccttcttctctgctcct 142  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||    
25015309 gttacttcaaatattgcagacaaattgccttcttcactggtcct 25015266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University