View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_low_31 (Length: 221)
Name: NF0920_low_31
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0920_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 25015409 - 25015266
Alignment:
| Q |
1 |
ccttgtttatatttgaatcattgtttcatacaatttaattatgnnnnnnnnnnnnnnn--aatatttgattctggattgatttgattctgtttgctgatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25015409 |
ccttgtttatatttgaatcattgtttcatacaatttaattatgatttttttattttttttaatatttgattctggattgatttgattctgtttgctgatt |
25015310 |
T |
 |
| Q |
99 |
gttacttcaaatattgcagacaaattgccttcttctctgctcct |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
25015309 |
gttacttcaaatattgcagacaaattgccttcttcactggtcct |
25015266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University