View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_low_32 (Length: 218)
Name: NF0920_low_32
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0920_low_32 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 12350767 - 12350565
Alignment:
| Q |
16 |
acgacgatggcggaagaagaggcatggttgagcgcatgagaactgcgcccacataggagtatagcaaccccaaacagggtgaaaagatagcgcggagggg |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12350767 |
acgacgatggcggaagaagaggcgtggttgagcgcatgagaactgcgcccacataagagtatagcaaccccaaacagggtgaaaagatagcgcagagggg |
12350668 |
T |
 |
| Q |
116 |
accttgttgcaccatcactgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggagcagagaggtcaga |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12350667 |
accttgttgcaccatcgctgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggtcaga |
12350568 |
T |
 |
| Q |
216 |
gga |
218 |
Q |
| |
|
||| |
|
|
| T |
12350567 |
gga |
12350565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University