View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920_low_34 (Length: 211)
Name: NF0920_low_34
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0920_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 7309687 - 7309829
Alignment:
Q |
1 |
tcatcaatcctatgtctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattttgagattcatcat |
100 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7309687 |
tcatcaatcctatgcctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattttgagattcatcat |
7309786 |
T |
 |
Q |
101 |
tcctacgtctctttcgagaactatatctttcatgatcatgatc |
143 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7309787 |
tcctacgtctctttcgagaactatatctttcatgatcatgatc |
7309829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 978 times since January 2019
Visitors: 6707