View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_high_17 (Length: 244)
Name: NF0921_high_17
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0921_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 28405010 - 28404778
Alignment:
| Q |
9 |
agcacagacatgattctgcccggctgcaacgtgagagtaggcggtggtcctgtatgctggtggaaccaaaatgggatctgcgttttgcttagaagttgca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28405010 |
agcacagacatgattctgcccggctgcaacgtgagagtaggcggtggtcctgtatgccggtggaaccaaaatgggatctgcgttttgcttagaagttgca |
28404911 |
T |
 |
| Q |
109 |
gcccaacaaaaaacttgtgaagtgttggctaaaatgccgcaaagaaaaccttcaccaccagaaagtgctgacatggcaggtatgttattaacatacgagg |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28404910 |
gcccaacaaaaaacttgggaagtgttggctaaaatgccgcaaagaaaaccttcaccaccagaaagtgctgacatggcaggtatgttattaacatacgagg |
28404811 |
T |
 |
| Q |
209 |
aagaagaaggaggttgtggtgaagttgtgtttt |
241 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
28404810 |
aagaagaaggagtttgtggtgaagttgtgtttt |
28404778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University