View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_low_10 (Length: 410)
Name: NF0921_low_10
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0921_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 32 - 325
Target Start/End: Complemental strand, 25666944 - 25666650
Alignment:
Q |
32 |
ttcatacccttgaggatgcccgacgagcagctcgaaatcggtgacgatgcggctcacggcgaggaggcttatgccctttggggtgatggagaaaaatatg |
131 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25666944 |
ttcatacccttgaggatgcccgacgagcagctcgaaatcggtgacgatgcggctcacggagaggaggcttatgccctttggggtgatggagaaaaatatg |
25666845 |
T |
 |
Q |
132 |
atccaactagacatggttcgttgaatactggtaacactggagtgtcaccttatgtcaatggtgcaagaggtgtgactataaatttatgagtcac-actca |
230 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
25666844 |
atccaactaggcatggttcgttgaatactggtaacactggagtgtcaccttatgttaatggtgcaagaggtgtgactataaatttatgagtcacaacttg |
25666745 |
T |
 |
Q |
231 |
caagtataggtattttgtgtatggaaggtgtgaggagaattttgatttttcccatggaagaaaagttctcaagttttgagatcaatttggttgtg |
325 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
25666744 |
caagtataggtgttttgtgtatggaaggtgtgaggagaattttgatttttcccatggaagaaaagttctcaagttttgagatcaaattggttgtg |
25666650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 32 - 140
Target Start/End: Complemental strand, 5622152 - 5622044
Alignment:
Q |
32 |
ttcatacccttgaggatgcccgacgagcagctcgaaatcggtgacgatgcggctcacggcgaggaggcttatgccctttggggtgatggagaaaaatatg |
131 |
Q |
|
|
|||||||| ||||||||| | |||| |||||||| | ||||| ||||| | ||||||||||| |||||||| |||||||||||||||||||| |||| |
|
|
T |
5622152 |
ttcataccgttgaggatgtcgaacgaccagctcgagactggtgatgatgctgtccacggcgaggaagcttatgcactttggggtgatggagaaaagtatg |
5622053 |
T |
 |
Q |
132 |
atccaacta |
140 |
Q |
|
|
| ||||||| |
|
|
T |
5622052 |
acccaacta |
5622044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15 times since January 2019
Visitors: 6713