View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0921_low_10 (Length: 410)

Name: NF0921_low_10
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0921_low_10
NF0921_low_10
[»] chr7 (1 HSPs)
chr7 (32-325)||(25666650-25666944)
[»] chr4 (1 HSPs)
chr4 (32-140)||(5622044-5622152)


Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 32 - 325
Target Start/End: Complemental strand, 25666944 - 25666650
Alignment:
32 ttcatacccttgaggatgcccgacgagcagctcgaaatcggtgacgatgcggctcacggcgaggaggcttatgccctttggggtgatggagaaaaatatg 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
25666944 ttcatacccttgaggatgcccgacgagcagctcgaaatcggtgacgatgcggctcacggagaggaggcttatgccctttggggtgatggagaaaaatatg 25666845  T
132 atccaactagacatggttcgttgaatactggtaacactggagtgtcaccttatgtcaatggtgcaagaggtgtgactataaatttatgagtcac-actca 230  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||      
25666844 atccaactaggcatggttcgttgaatactggtaacactggagtgtcaccttatgttaatggtgcaagaggtgtgactataaatttatgagtcacaacttg 25666745  T
231 caagtataggtattttgtgtatggaaggtgtgaggagaattttgatttttcccatggaagaaaagttctcaagttttgagatcaatttggttgtg 325  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
25666744 caagtataggtgttttgtgtatggaaggtgtgaggagaattttgatttttcccatggaagaaaagttctcaagttttgagatcaaattggttgtg 25666650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 32 - 140
Target Start/End: Complemental strand, 5622152 - 5622044
Alignment:
32 ttcatacccttgaggatgcccgacgagcagctcgaaatcggtgacgatgcggctcacggcgaggaggcttatgccctttggggtgatggagaaaaatatg 131  Q
    |||||||| ||||||||| |  |||| |||||||| |  ||||| ||||| |  ||||||||||| |||||||| |||||||||||||||||||| ||||    
5622152 ttcataccgttgaggatgtcgaacgaccagctcgagactggtgatgatgctgtccacggcgaggaagcttatgcactttggggtgatggagaaaagtatg 5622053  T
132 atccaacta 140  Q
    | |||||||    
5622052 acccaacta 5622044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 15 times since January 2019
Visitors: 6713