View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_low_13 (Length: 380)
Name: NF0921_low_13
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0921_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 76 - 287
Target Start/End: Complemental strand, 16633185 - 16632979
Alignment:
Q |
76 |
gatgaatgttgtaccaagnnnnnnnggtgatgaatgaatgactgctagctagctaattgtttaatataggcgaccaccatgtcaacgattacaaacgtca |
175 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16633185 |
gatgaatgttgtaccaagaaaaaaaggtgatgaatgaatgactgctagctagctaattgtttaatataggcgaccaccatgtcaacgattacaaacgtca |
16633086 |
T |
 |
Q |
176 |
gcagcatcatgtctgccatagacatcatccttaatcttcatgtttatcacgttctgtttttataagtgaaacaagagataatatatacatagtagggtct |
275 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
16633085 |
gcagcatcatgtctgccatagacatcatccttaatcttcatgtttatcac-----gtttttataagtgaaacaagagataatatatacatagtagtgtct |
16632991 |
T |
 |
Q |
276 |
tggtagtttcct |
287 |
Q |
|
|
|||||||||||| |
|
|
T |
16632990 |
tggtagtttcct |
16632979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 533 times since January 2019
Visitors: 6717