View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_low_18 (Length: 315)
Name: NF0921_low_18
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0921_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 75 - 149
Target Start/End: Complemental strand, 45946261 - 45946186
Alignment:
| Q |
75 |
atgaaccatcatagtaaaaagaaaaatgaaggcatgcacacacgtgtggtgatttcaatt-ttttagagatcatgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45946261 |
atgaaccatcatagtaaaaagaaaaatgaaggcatgcacacacgtgtggtgatttcaatttttttagagatcatgt |
45946186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 185 - 224
Target Start/End: Complemental strand, 45946178 - 45946139
Alignment:
| Q |
185 |
ataagtggactaaaaagatactatagattaagtagtaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45946178 |
ataagtggactaaaaagatactatagattaagtagtaatt |
45946139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 740 times since January 2019
Visitors: 6719