View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_low_26 (Length: 275)
Name: NF0921_low_26
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0921_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 50 - 237
Target Start/End: Complemental strand, 39377096 - 39376910
Alignment:
| Q |
50 |
atcaagatgaattcttttgtttttaattacatgtttggaacaaaggattgatcctcttgccatcaataagatgttggcacaaaatcaattatggtctcta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39377096 |
atcaagatgaattcttttgtttttaattacatgtttggaacaaaggattgatcctcttgccatcaataagatgttggcacaaaatcaattatggtctcca |
39376997 |
T |
 |
| Q |
150 |
aagaaccaataatactcttactcacaattaagtgnnnnnnnnagaggcacaattaagtgacttgacacatcaacaagttcagtttcat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39376996 |
aagaaccaataatactcttactcacaattaagtg-tttttttagaggcacaattaagtgacttgacacatcaacaagttctgtttcat |
39376910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University