View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_low_5 (Length: 490)
Name: NF0921_low_5
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0921_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 5e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 38055526 - 38055466
Alignment:
| Q |
129 |
aaatgttttcaatttgtcaagtaatcgaagcacattatgtcgaaatagaaaagtaattgaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38055526 |
aaatgttttcaatttgtcaagtaatcgaagcacattatgtcgaaatagaaaagtaattgaa |
38055466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 222 - 265
Target Start/End: Complemental strand, 38055479 - 38055436
Alignment:
| Q |
222 |
gaaaagtaattgaagcactgaattttgtgtcaacatagaataat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38055479 |
gaaaagtaattgaagcactgaattttgtgtcaacatagaataat |
38055436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 286 times since January 2019
Visitors: 6702