View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0921_low_8 (Length: 443)
Name: NF0921_low_8
Description: NF0921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0921_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 98 - 395
Target Start/End: Complemental strand, 39824807 - 39824510
Alignment:
| Q |
98 |
aaaccatggttcccaacatccaaagctttaactacctttggtgacacaaactgcatggaacagttacttgttcattgcgcaaacgcaatcgaaacaaacg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824807 |
aaaccatggttcccaacatccaaagctttaactacctttggagacacaaactgcatggaacagttacttgttcattgcgcaaacgcaatcgaaacaaacg |
39824708 |
T |
|
| Q |
198 |
atgtaacacttgctcaacaaatcctttgggttctcaataacatagcaccacaagacggtgattcaaatcaacgcttagcttatagtttccttagagccct |
297 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824707 |
atgtaacacttgctcagcaaatcctttgggttctcaataacatagcaccacaagacggtgattcaaatcaacgcttagcttatagtttccttagagccct |
39824608 |
T |
|
| Q |
298 |
cacaaatcgtgcagtgaaaaccggtacctgtaaaatgctagtagaacaagtttattcaaatgctcataacaatctcaccatagatacacacaggttct |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39824607 |
cacaaatcgtgcagtgaaaaccggtacctgtaaaatgctagtagaacaagtttattcaaatgctcataacaatctcaccatagatacacacagattct |
39824510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 395 times since January 2019
Visitors: 6696