View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_high_10 (Length: 458)
Name: NF0922_high_10
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 75 - 361
Target Start/End: Complemental strand, 52824403 - 52824117
Alignment:
| Q |
75 |
gaggagcacagatcctacgcatgctctcgctagagaaagaaaccagaatattttcctcatgaatatgataattagcatcatcatgcactatatgattctg |
174 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824403 |
gaggaacacagatcctacgcatgctctcgctagagaaagaaaccagaatattttcctcatgaatatgataattagcatcatcatgcactatatgattctg |
52824304 |
T |
 |
| Q |
175 |
gtgttgtagttcatgagagggaacagaagaagaaggggaatcaaggaaatcttcaaacttccaacctgggatagtgtttatcaagtactcagatatagta |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824303 |
gtgttgtagttcatgagagggaacagaagaagaaggggaatcaaggaaatcttcaaacttccaacctgggatagtgtttatcaagtactcagatatagta |
52824204 |
T |
 |
| Q |
275 |
aaattaccagtttcttcatgaagagtgggaggaggagcaggagagtgcagcttgatcccacttagaagaaacctattatgcttcttg |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824203 |
aaattaccagtttcttcatgaagagtgggaggaggagcaggagagtgcagcttgatcccacttagaagaaacctattatgcttcttg |
52824117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University