View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_high_12 (Length: 432)
Name: NF0922_high_12
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 322; Significance: 0; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 57 - 401
Target Start/End: Original strand, 38038680 - 38039025
Alignment:
Q |
57 |
cttaattagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatgattttactagcttattgggt |
156 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
38038680 |
cttaactagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatcattttactagcttattgggt |
38038779 |
T |
 |
Q |
157 |
attatggtataaggtaccacttttttgatgtacaatataaaagag-aaatacagtaaaaagagactgactatgattaagcaattctgaaaactggggttt |
255 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
38038780 |
attatggtataaggtaccacttttttgatgtacaatataaaagaggaaatacagtaaaaagagactaactatgattaagcaattctgaaaactggggttt |
38038879 |
T |
 |
Q |
256 |
atatcttgttgtagattcaccaatttttcttgcttatacaagcttaagcatatagtataaatgaatcatcatctaacggaactgctagtccttaagccaa |
355 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38038880 |
atatcttgttgtagattcaccaatttttcttgcttatacaagcttaagcatatagtataaatgaatcatcatctaacggaactgctagtccttaagccaa |
38038979 |
T |
 |
Q |
356 |
ttctttgtatttgaggtgatgacaccacaggttcagacacgtaaaa |
401 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
38038980 |
ttctttgtatttgaggtgatgacaccacaggttcagacacgcaaaa |
38039025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 38025340 - 38025404
Alignment:
Q |
119 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
183 |
Q |
|
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
T |
38025340 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38025404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 38030739 - 38030803
Alignment:
Q |
119 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
183 |
Q |
|
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
T |
38030739 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38030803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1299 times since January 2019
Visitors: 6712