View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_high_26 (Length: 332)
Name: NF0922_high_26
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 47 - 303
Target Start/End: Original strand, 9232098 - 9232354
Alignment:
| Q |
47 |
tgttctcggggaaatactatgtacaacacattgattacaagagatttaaaatttcgttaagtgacgcgggtgcagtggaagacactaattgctcttttat |
146 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9232098 |
tgttctccgggaaatactatgtacaacacattgattacaagggatttaaaattcgattaagtgacgcgggtgcagtggaagatgctaattgctcttttat |
9232197 |
T |
|
| Q |
147 |
cccacggtactttttatacgatcgaagttttaataatgttctttttggcgaagacaattttggatctgaaccgttcattctggatccaataaatccattg |
246 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9232198 |
cccacggtactttttatatgatcaaagttttaataatgttctttttggagaagacaattttggatctgaaccgttcattctggatccaataaatccattg |
9232297 |
T |
|
| Q |
247 |
agaatagcgtatttcaattgttcaagtccaataaaagatccacggtacgttaaggtg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9232298 |
agaatagcgtatttcaattgttcaagtccaataaaagatccacggtacgttaaggtg |
9232354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 47 - 164
Target Start/End: Complemental strand, 9386547 - 9386430
Alignment:
| Q |
47 |
tgttctcggggaaatactatgtacaacacattgattacaagagatttaaaatttcgttaagtgacgcgggtgcagtggaagacactaattgctcttttat |
146 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
9386547 |
tgttctccgggaaatactatgtacaacacatagattacaagaggtttataattcgattaagtgacgcgggtgcagtggaagatgctaattgctctttcat |
9386448 |
T |
|
| Q |
147 |
cccacggtactttttata |
164 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
9386447 |
cccgcggtactttttata |
9386430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 290 times since January 2019
Visitors: 6702