View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_high_36 (Length: 253)
Name: NF0922_high_36
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40785240 - 40785018
Alignment:
| Q |
1 |
tatatatccagtataaaggtaagtggcaatcaacaaacaaatcattgttaaaagagattgtattcaggtggaattatggattgtagaaggaaacaagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40785240 |
tatatatccagtataaaggtaagtggcaatcaacaaacaaatcattgttaaaagagattgtattcaggtggaattatggattgtagaaggaaacaagcta |
40785141 |
T |
 |
| Q |
101 |
atacttgaggtcaattatttgtgagtgcctacctgatatgatacgagcaggtggatagctaggctgttgattgataaaaatagttctccatatatatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40785140 |
-tacttgaggtcaattatttgtgagtgcctacctgatatgatatgagcaggtggatagctaggctgttgattcataaaaatagttctccatatatatttt |
40785042 |
T |
 |
| Q |
201 |
atttaccaaattgatcataataat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40785041 |
atttaccaaattgatcataataat |
40785018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 158 - 215
Target Start/End: Complemental strand, 40792432 - 40792376
Alignment:
| Q |
158 |
gctaggctgttgattgataaaaatagttctccatatatattttatttaccaaattgat |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
40792432 |
gctaggctgttgattggtagaaatagttctacatatatatacta-ttaccaaattgat |
40792376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University