View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_high_39 (Length: 251)
Name: NF0922_high_39
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 121 - 244
Target Start/End: Original strand, 30742261 - 30742384
Alignment:
Q |
121 |
agtctcaaccgttgtctttcttggtattgtctacaacgtatggaacaacctatcataaattatccatgtcccatcacagcacaaagaaaacgatcatcgc |
220 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
30742261 |
agtctcaaccgttgtctttcttggtattgtcaacaacgtatggaacaacctatcataaattatccatgtcccaccacagcacaaagaaaacgatcatcgc |
30742360 |
T |
 |
Q |
221 |
ctttccatatggttgtctctgctc |
244 |
Q |
|
|
|||||||||||||||||| ||||| |
|
|
T |
30742361 |
ctttccatatggttgtctttgctc |
30742384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University